Main Menu
Home
Filter
Single
Multiple
Group
Retrieve
Help
Feedback
About Us
 
Useful Links
miRanalyser
miRBase
Rfam
UCSC
miRDeep
 
   

  Adaptor trimming script introduction and download

 

To avoid upload of initial Solexa raw fastq data with large file size, mirTools only support specified input file (*.fa or *.gz or *.zip, Max 10M) with the follow format:

An example sequence tag format is:
>sample_260_x80 ("sample_260" represents an unique ID, "80" is read counts)
CATTTATTATTTATCTTATTCCTTCTTCTTTTTTA

In order to generate the proper input format of mirTools, here, a Perl script is provided.

Adapter_trim.pl.gz Download

Description: Perl script used to filter low quality short reads, remove polyA, trim 3'/5' adapter and generate the the proper input format of mirTools
Author: zhuerle@163.com
Usage: perl Adapter_trim.pl [options] >outputfile
Options:
-i  <file> Short reads file in fastq format
-n <str>  Sample name; default="sample"
-x <str>  5' adaptor sequence, default="GTTCAGAGTTCTACAGTCCGACGATC";
-y <str>  3' adaptor sequence, default="TCGTATGCCGTCTTCTGCTTG";
-f  <int>  Fastq file format: 1=Sanger format; 2=Solexa/Illumina 1.0 format; 3=Illumina 1.3+ format; default=2;
-h           Help
Examples: perl Adapter_trim.pl -i sample.fq -n "newid" -f 1 >outputfile
                perl Adapter_trim.pl -i sample.fq -x "ATCGGGCT" -y "TCGTAT" -f 3 >outputfile

 
 
Institute of Genomic Medicine/Zhejiang Provincial Key Laboratory of Medical Genetics,
Wenzhou Medical College, Wenzhou 325035, China