To avoid upload of initial Solexa raw fastq data with large file size, mirTools only support specified input file (*.fa or *.gz or *.zip, Max 10M) with the follow format:
An example sequence tag format is:
>sample_260_x80 ("sample_260" represents an unique ID, "80" is read counts)
CATTTATTATTTATCTTATTCCTTCTTCTTTTTTA
In order to generate the proper input format of mirTools, here, a Perl script is provided. |